frmd8

Ensembl ID:
ENSDARG00000073696
ZFIN ID:
ZDB-GENE-090812-5
Human Orthologue:
FRMD8
Human Description:
FERM domain containing 8 [Source:HGNC Symbol;Acc:25462]
Mouse Orthologue:
Frmd8
Mouse Description:
FERM domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1914707]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21752 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114457 Nonsense 466 471 9 10
ENSDART00000135493 Nonsense 466 471 10 10
Genomic Location:
Chromosome 10 (position 27593399)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTACAAGGCAAGCGCAGCCTCCCACTTACTCTGCTGTTCAGGTGACT[G/T]AAAGTTTAGAGCAAGGGTGAACCCAGGCCTCAACACTGCCCTCTTCTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fe5iy5x2