si:ch211-117o11.4

Ensembl ID:
ENSDARG00000073695
ZFIN ID:
ZDB-GENE-091117-16
Human Orthologue:
MAMDC2
Human Description:
MAM domain containing 2 [Source:HGNC Symbol;Acc:23673]
Mouse Orthologue:
Mamdc2
Mouse Description:
MAM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918988]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21690 Nonsense Available for shipment Available now
sa12718 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109231 Nonsense 71 698 3 14
Genomic Location (Zv9):
Chromosome 10 (position 15696591)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15709898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATGAATTTTGTTTTCCTTCTGCTTGCTCAGGACATTTCATAACAGTC[G/T]AAGAGCAGGTCCAGGAGGACCAGAGGAAGGCGGTTCTTCTGGGTCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109231 Nonsense 613 698 12 14
Genomic Location (Zv9):
Chromosome 10 (position 15680369)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15693676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGTATGGYTCTGGGATTGGCCAGCTGAGTGTTTACCTCCAGACCGGA[C/T]AAGAAAACGAYGACAGACTGTTGTGGACGAGCCATGGAGAGCAGGGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link