NAV2 (1 of 2)

Ensembl ID:
ENSDARG00000073688
Description:
neuron navigator 2 [Source:HGNC Symbol;Acc:15997]
Human Orthologue:
NAV2
Human Description:
neuron navigator 2 [Source:HGNC Symbol;Acc:15997]
Mouse Orthologue:
Nav2
Mouse Description:
neuron navigator 2 Gene [Source:MGI Symbol;Acc:MGI:2183691]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15972 Nonsense Available for shipment Available now
sa40851 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30884 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34024 Nonsense Mutation detected in F1 DNA During 2017
sa7061 Nonsense Mutation detected in F1 DNA During 2017
sa15602 Nonsense Available for shipment Available now
sa10172 Nonsense Available for shipment Available now
sa9986 Essential Splice Site Available for shipment Available now
sa31554 Essential Splice Site Available for shipment Available now
sa25358 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 56 2347 1 37
Genomic Location (Zv9):
Chromosome 7 (position 17581878)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16554667
KASP Assay ID:
2259-8566.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCCCCYRCAGAGCAGCGCTCATCTCCACCTCCAGAGCCAAAGYGGGTG[G/A]ATGACAAGCAAAAACTATCRCAATGTTGACAGTGGAGAGGACACACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Essential Splice Site 267 2347 6 37
ENSDART00000113332 Essential Splice Site 267 2347 6 37
Genomic Location (Zv9):
Chromosome 7 (position 17680574)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16653363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCTGGTGTTCAGCGATAAAGCCAAACCTGCAGCAGCTCAGGCCAAAG[G/A]TAAACACAACTGAATTACTTTAGCTGAACACTGCACTTGCAGACTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Essential Splice Site 267 2347 6 37
ENSDART00000113332 Essential Splice Site 267 2347 6 37
Genomic Location (Zv9):
Chromosome 7 (position 17680574)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16653363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCTGGTGTTCAGCGATAAAGCCAAACCTGCAGCAGCTCAGGCCAAAG[G/A]TAAACACAACTGAATTACTTTAGCTGAACACTGCACTTGCAGACTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 459 2347 7 37
Genomic Location (Zv9):
Chromosome 7 (position 17691323)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16664112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGAAATCTTCAGAGAAAGAAAAGGGCAAAGACAAAAATGCATCCAAG[C/T]GAGGCTCTCCTTCAGAAAAGGTAGAGGAGGTCAAGGAAGAAGTGGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 684 2347 9 37
Genomic Location (Zv9):
Chromosome 7 (position 17694429)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16667218
KASP Assay ID:
554-4569.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGCCTGAGGACTGTCAAAAACATCGCTGACCTGCGGCARAATYTAGAA[G/T]AAACCATGTCCAGTTTACGGGGGACACAAATCACTCACAGGTAGACANTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 765 2347 10 37
Genomic Location (Zv9):
Chromosome 7 (position 17697513)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16670302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGGTATCAGTCCYGCAGCGGRGGGGTTGCAYCCGGCCAGGGCCGCTA[T/A]CTGTATCAGGCTCCCCTACGGAAGCAGCTGGCAGCACGCGGCAGTGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 1024 2347 14 37
Genomic Location (Zv9):
Chromosome 7 (position 17732811)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16705600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTMATCCRTTAGGCAAAACAGATGACGCCAAGGTYTCGGAAAAAGGTYG[C/A]ATGTCTCCCTCTTCCAACATCCTTCAGCATTCCTCCTCRGACACYGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Essential Splice Site 1695 2347 25 37
Genomic Location (Zv9):
Chromosome 7 (position 17774394)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16747183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTTTTTCAGKAACTCTAGACTCATGACCTGTCTCTGTTATCATTGCA[G/A]CTTCGCAGCTCCTTCAAACAGGCCTTCAGTAAGAAGAAATCCCCTAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Essential Splice Site 1923 2347 29 37
Genomic Location (Zv9):
Chromosome 7 (position 17779695)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16752484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAACCAAGTGGGATGTTCTCGATGGAGTTGTACGGCGCTTGTTTAAGG[T/G]AAATACATTTATAATAATTATTTGATGAGGATGAGTCATTTACATTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113332 Nonsense 2106 2347 32 37
Genomic Location (Zv9):
Chromosome 7 (position 17783550)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16756339
KASP Assay ID:
554-7786.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACCACATCAGCTCACTGGGAGAGATCTTCAGTGGCCTCCTCAATTGC[A/T]GATACCAGCGCTGGTCAGTCAGCATTTATAAACACACTACCATTCAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link