quo

Ensembl ID:
ENSDARG00000073684
ZFIN ID:
ZDB-GENE-030131-9944
Description:
quattro [Source:RefSeq peptide;Acc:NP_001004109]
Human Orthologue:
KIAA1755
Human Description:
KIAA1755 [Source:HGNC Symbol;Acc:29372]
Mouse Orthologue:
D630003M21Rik
Mouse Description:
RIKEN cDNA D630003M21 gene Gene [Source:MGI Symbol;Acc:MGI:3606579]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33788 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10332 Essential Splice Site Available for shipment Available now
sa26650 Nonsense Mutation detected in F1 DNA During 2017
sa17343 Nonsense Available for shipment Available now
sa7021 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109679 Essential Splice Site 68 1988 3 23
Genomic Location (Zv9):
Chromosome 6 (position 1886503)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1916738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAAATTATCTGCGAATCAACAAACTAGCTCTGTCTTTCTTGTTCTCT[A/T]GGCTGCATATTCCGATGTCCTGTTCCAGTGTGAGGGTTGGCCATTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109679 Essential Splice Site 1134 1988 14 23
Genomic Location (Zv9):
Chromosome 6 (position 1904276)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1934511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWAAACATTCKAAATATWTTCAGTCTAAAWTGACTTCTTCTTTGTCCCCC[A/T]GGCCTCGTCTCTTGTGAAGGAGTGTAYGGAGTATTTAGATCACATGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109679 Nonsense 1270 1988 14 23
Genomic Location (Zv9):
Chromosome 6 (position 1904686)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1934921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGAGGGATCAAAGTTTGAGCAAGTAATGACTTCAAGCGTGCATGAA[C/T]AATCTGCATCACGCATTCAACAATCTGTTGAATGCACAGAACAAGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109679 Nonsense 1289 1988 14 23
Genomic Location (Zv9):
Chromosome 6 (position 1904744)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1934979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACRCATTCAACAAYCTGTTGAATGCAYAGAACAARAAACAAGRCATT[T/A]GCATGAAACTAAAGACAAATTACACAATGCCTCAAGCATGCATAATGMAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109679 Nonsense 1312 1988 14 23
Genomic Location (Zv9):
Chromosome 6 (position 1904812)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1935047
KASP Assay ID:
554-5160.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTACACAATGCCTCAAGCATGCATAATGMATCTRCATCACATGCTCAA[C/T]AATCTGTTCAATGCACAGTCCAAAAAGCCAGTATGTTGCAGGAAACTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link