tlr8b

Ensembl ID:
ENSDARG00000073675
ZFIN ID:
ZDB-GENE-040219-12
Description:
cDNA, clone cssl:d0554 [Source:UniProtKB/TrEMBL;Acc:A8BBI2]
Human Orthologue:
TLR8
Human Description:
toll-like receptor 8 [Source:HGNC Symbol;Acc:15632]
Mouse Orthologue:
Tlr8
Mouse Description:
toll-like receptor 8 Gene [Source:MGI Symbol;Acc:MGI:2176887]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4396 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114208 Nonsense 456 802 1 2
Genomic Location:
Chromosome 10 (position 45345310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACAAATGAAGAGTTCCGCCATTATCCTCCATTCACCAAAGCCGAGTG[T/A]CTTGCAACTGGACCAGTTTTGGATCTCAGCAGGAACAACATTTACCACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oa0ezbny