GPR125 (2 of 2)

Ensembl ID:
ENSDARG00000073673
Description:
G protein-coupled receptor 125 [Source:HGNC Symbol;Acc:13839]
Human Orthologue:
GPR125
Human Description:
G protein-coupled receptor 125 [Source:HGNC Symbol;Acc:13839]
Mouse Orthologue:
Gpr125
Mouse Description:
G protein-coupled receptor 125 Gene [Source:MGI Symbol;Acc:MGI:1917943]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25377 Nonsense Mutation detected in F1 DNA During 2017
sa34241 Nonsense Available for shipment Available now
sa21149 Nonsense Available for shipment Available now
sa34240 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112969 Nonsense 864 1183 24 27
Genomic Location (Zv9):
Chromosome 7 (position 72819975)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69817873
KASP Assay ID:
554-7473.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACTTTTGTTTCCCAGCTCATGGGTGTTGCAGGATCCCTAACTCTTTA[C/A]GCAGCACTCTGGGTGTTTGGTGCTCTCGCAATATCTCAAGAGCATCCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112969 Nonsense 1030 1183 26 27
Genomic Location (Zv9):
Chromosome 7 (position 72819425)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69817323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCAGTTCGGTCAACAACAACAATCTTCCAGGCAATGCTAATATTACC[G/T]GACACCCAGGGCGGCATCACAAGAACCGTTCAAGAGCGCATCGGGCTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112969 Nonsense 1090 1183 26 27
Genomic Location (Zv9):
Chromosome 7 (position 72819244)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69817142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCATCACGAGAGCCTACACGCTCGTAATAGTCGTCGGGCAGCCTATT[T/A]GGCATACCGAGAACGCCAGCAGAGCCAGCTTCAGCAGGACAGCAGTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112969 Nonsense 1177 1183 27 27
Genomic Location (Zv9):
Chromosome 7 (position 72818916)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69816814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAGAGACTAAATGTTGAGAGTTCGGGGAATGTTAAGACTGGCTTGTG[G/A]AAGCATGAAACTACTGTGTAGAGACTGCGAATCAGACTTTTGCCTGTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link