ncstn

Ensembl ID:
ENSDARG00000073668
ZFIN ID:
ZDB-GENE-050131-1
Description:
nicastrin [Source:RefSeq peptide;Acc:NP_001009556]
Human Orthologue:
NCSTN
Human Description:
nicastrin [Source:HGNC Symbol;Acc:17091]
Mouse Orthologue:
Ncstn
Mouse Description:
nicastrin Gene [Source:MGI Symbol;Acc:MGI:1891700]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19912 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114500 Nonsense 86 254 3 12
Genomic Location (Zv9):
Chromosome 2 (position 58113721)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58197355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACATCAATCAATCAACCAACCAACCTTTATTTATATATCAGCCTACTA[C/A]AACCAAAGTGCTTTACACCAGTAAAAACAAATTATACAACAAAACTTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link