si:dkey-169a9.2

Ensembl ID:
ENSDARG00000073665
ZFIN ID:
ZDB-GENE-090311-50
Human Orthologue:
RASA1
Human Description:
RAS p21 protein activator (GTPase activating protein) 1 [Source:HGNC Symbol;Acc:9871]
Mouse Orthologue:
Rasa1
Mouse Description:
RAS p21 protein activator 1 Gene [Source:MGI Symbol;Acc:MGI:97860]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41739 Nonsense Mutation detected in F1 DNA During 2017
sa34987 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108954 Nonsense 623 1032 14 25
ENSDART00000132486 Nonsense 461 652 13 17
ENSDART00000141543   None 209 None 7
ENSDART00000148205   None 95 None 2

The following transcripts of ENSDARG00000073665 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 44909437)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43603025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATTCAGGTGGCAAAAACCCACCCGCGGGAAGGCCAGAACCCCGTGTG[G/A]ACGGAGGAGTTCATTTTCGAGTAAACCAATGTTCATACCGATTTGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108954 Nonsense 978 1032 24 25
ENSDART00000132486   None 652 None 17
ENSDART00000141543 Nonsense 156 209 6 7
ENSDART00000148205   None 95 None 2

The following transcripts of ENSDARG00000073665 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 44921711)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43615299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGTCTGAGCTGCCAGAGCCCACAGAGCACTTTAACACAGATGTGGCT[C/T]GAGATCTGGCTGCTCTGCATCAGCTCTGCGTCACACATCTGGATGAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link