pcdh2ab1

Ensembl ID:
ENSDARG00000071904
ZFIN ID:
ZDB-GENE-041118-1
Description:
protocadherin 2 alpha b 1 [Source:RefSeq peptide;Acc:NP_001009588]
Human Orthologues:
PCDHA1, PCDHA10, PCDHA11, PCDHA12, PCDHA13, PCDHA2, PCDHA3, PCDHA4, PCDHA5, PCDHA6, PCDHA7, PCDHA8, PCDHA9
Human Descriptions:
protocadherin alpha 1 [Source:HGNC Symbol;Acc:8663]
protocadherin alpha 10 [Source:HGNC Symbol;Acc:8664]
protocadherin alpha 11 [Source:HGNC Symbol;Acc:8665]
protocadherin alpha 12 [Source:HGNC Symbol;Acc:8666]
protocadherin alpha 13 [Source:HGNC Symbol;Acc:8667]
protocadherin alpha 2 [Source:HGNC Symbol;Acc:8668]
protocadherin alpha 3 [Source:HGNC Symbol;Acc:8669]
protocadherin alpha 4 [Source:HGNC Symbol;Acc:8670]
protocadherin alpha 5 [Source:HGNC Symbol;Acc:8671]
protocadherin alpha 6 [Source:HGNC Symbol;Acc:8672]
protocadherin alpha 7 [Source:HGNC Symbol;Acc:8673]
protocadherin alpha 8 [Source:HGNC Symbol;Acc:8674]
protocadherin alpha 9 [Source:HGNC Symbol;Acc:8675]
Mouse Orthologue:
AC020968.2
Mouse Description:
protocadherin alpha-3 [Source:RefSeq peptide;Acc:NP_619603]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28237 Nonsense Mutation detected in F1 DNA During 2017
sa6333 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106704 Nonsense 308 794 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2496047)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2302533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATTGATGCACAGAGTGGAGATGTGAAAATCAAGGGTGATATTGATTA[T/A]GAGGAGAGTACGGCGTTTGAGATCAGAGTTCAGGCGACTGATAAAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106704 Nonsense 461 794 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2496506)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2302074
KASP Assay ID:
554-4941.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTGAATGACAAYGCGCCTCGCTTTGCAARTAGTGTTGAGTATGCGTA[T/A]CWGCGAGAAAATAGCAACGTGGGGACTGTTATAATGACACTGACAGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link