nrp1a

Ensembl ID:
ENSDARG00000071865
ZFIN ID:
ZDB-GENE-030519-2
Description:
Neuropilin-1a [Source:UniProtKB/Swiss-Prot;Acc:Q8QFX6]
Human Orthologue:
NRP1
Human Description:
neuropilin 1 [Source:HGNC Symbol;Acc:8004]
Mouse Orthologue:
Nrp1
Mouse Description:
neuropilin 1 Gene [Source:MGI Symbol;Acc:MGI:106206]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32 Missense Confirmed mutation in F2 line During 2017
sa24430 Nonsense Available for shipment Available now
sa1485 Nonsense Available for shipment Available now
sa24429 Nonsense Available for shipment Available now
sa37806 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106639 Missense 84 923 3 17
ENSDART00000129263 Missense 84 923 3 17
ENSDART00000129276 Missense 84 926 3 17
ENSDART00000130586 Missense 84 341 3 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 1261448)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1252764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGATGAATGTGTGTTCATGTGTGTGTTTCTCTCTCTGCAGATATGAC[T/A]ATGTGGAAGTGAGAGACGGCGTGGATGAGAACGGGCAGCTGGTGGGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106639 Nonsense 125 923 3 17
ENSDART00000129263 Nonsense 125 923 3 17
ENSDART00000129276 Nonsense 125 926 3 17
ENSDART00000130586 Nonsense 125 341 3 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 1261323)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1252639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGTGGTCTCGTCGGGAAACCAGCTCTTCATCAAGTTTGTGTCCGACTA[C/A]GAGACTCACGGTGCCGGATTCTCCATCCGCTATGAGATCTTCAAAACGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106639 Nonsense 206 923 4 17
ENSDART00000129263 Nonsense 206 923 4 17
ENSDART00000129276 Nonsense 206 926 4 17
ENSDART00000130586 Nonsense 206 341 4 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 1248914)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1240230
KASP Assay ID:
554-1410.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGAGCTGGAGCCAGACACGCAGCCGCCCGCCGGAGTCTTCTGCCGATA[C/A]GACCGCCTGGAGATTTGGGACGGATTCCCTGGAGGTGAGTCAATGGAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa24429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106639 Nonsense 305 923 6 17
ENSDART00000129263 Nonsense 305 923 6 17
ENSDART00000129276 Nonsense 305 926 6 17
ENSDART00000130586 Nonsense 305 341 6 8
Genomic Location (Zv9):
Chromosome 24 (position 1233964)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1225280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCATGGCCTCGTCCCAGTACAGCAACAGCTGGTCAGCAGAACGATCA[C/T]GACTCAACAACCCAGAGAACGGCTGGACGCCTTTGGAGGACACGAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106639 Nonsense 409 923 8 17
ENSDART00000129263 Nonsense 409 923 8 17
ENSDART00000129276 Nonsense 409 926 8 17
ENSDART00000130586   None 341 None 8
Genomic Location (Zv9):
Chromosome 24 (position 1208353)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1199669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCCAAAGCCCACGCTGACCCGATACCTGCGGATCCGACCCATTAACT[G/A]GGAAACTGGCATCGCACTGCGGTTCGAGGTCTACGGATGCAAGATCTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link