itgb1a

Ensembl ID:
ENSDARG00000071863
ZFIN ID:
ZDB-GENE-060803-2
Description:
integrin, beta 1a [Source:RefSeq peptide;Acc:NP_001030143]
Human Orthologue:
ITGB1
Human Description:
integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) [Source
Mouse Orthologue:
Itgb1
Mouse Description:
integrin beta 1 (fibronectin receptor beta) Gene [Source:MGI Symbol;Acc:MGI:96610]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24428 Nonsense Available for shipment Available now
sa30023 Nonsense Mutation detected in F1 DNA During 2017
sa8902 Nonsense Mutation detected in F1 DNA During 2017
sa24427 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039700 Nonsense 47 798 2 15
Genomic Location (Zv9):
Chromosome 24 (position 1144055)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1135371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGCTTTGTCCTGCGGCGAGTGCATACAAGTGGGGGACAAATGTGGATG[G/A]TGCACTGATGCGGTGAGTGTGTGTTCATAAGCCTCACTCGCTCCTTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039700 Nonsense 66 798 3 15
Genomic Location (Zv9):
Chromosome 24 (position 1142605)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1133921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGACAGGAGTTTCTGAAGCAGGGAGAGCCGACATCGGCGCGCTGTGAT[G/T]AGCTGGAGTCGCTCAAGAAAAGAGGCTGCGCAGAAGATAAGATCGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039700 Nonsense 434 798 10 15
Genomic Location (Zv9):
Chromosome 24 (position 1136838)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1128154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTATATCTCCAGGTGTCGTTCAACATTAACATCACGGCTCAAGGCTG[C/A]CCTAAACAAGGCAAGACAGAGACCATAAAGATCAAGCCGCTGGGCTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039700 Nonsense 691 798 13 15
Genomic Location (Zv9):
Chromosome 24 (position 1133277)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1124593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCGAGACAAACTCCCGCAGCCGGTGCAGGCCTTTCCACTAATGCACTG[C/A]AAGGAGAGAGATGCGCGAGACTGCTGGTTCTACTACACATACGCCGTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link