NP_001106975.1

Ensembl ID:
ENSDARG00000071837
Description:
growth hormone-releasing hormone receptor second type [Source:RefSeq peptide;Acc:NP_001106975]
Human Orthologue:
GHRHR
Human Description:
growth hormone releasing hormone receptor [Source:HGNC Symbol;Acc:4266]
Mouse Orthologue:
Ghrhr
Mouse Description:
growth hormone releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95710]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9992 Nonsense Available for shipment Available now
sa22022 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106552 Nonsense 75 411 3 13
Genomic Location (Zv9):
Chromosome 12 (position 6010709)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4812329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGATGGTGTGAACTGCTGGYCTGCTGTCAGTGTAGGAGAAAGAGTCT[C/A]AGTGTCTTGCCCTCCTCTTCTGAAATCTCACGGTAAATCTTCTCTYACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106552 Nonsense 245 411 7 13
Genomic Location (Zv9):
Chromosome 12 (position 6006269)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4816769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGCTTACGTTCACCTTCGCCCACAAAAGAACATTTTTCTGGTGCTA[T/A]ACACTTGTTGGCTGGGGTAAAATCACATTTGATCTTAAAAGAAGTTGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link