NP_001007219.1

Ensembl ID:
ENSDARG00000071780
Description:
neuropeptide Y receptor Y7 [Source:RefSeq peptide;Acc:NP_001007219]
Human Orthologue:
NPY2R
Human Description:
neuropeptide Y receptor Y2 [Source:HGNC Symbol;Acc:7957]
Mouse Orthologue:
Npy2r
Mouse Description:
neuropeptide Y receptor Y2 Gene [Source:MGI Symbol;Acc:MGI:108418]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22454 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106404 Nonsense 184 372 1 1
Genomic Location (Zv9):
Chromosome 14 (position 19922714)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15717167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGACTTGGGCATTCGCTGCCATACTGGCTGGCCCACTGGCCATTTTC[C/T]GAGAGTATCGATACGAGGAAATCCCTTACATCGACTTACGAATTGCGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link