ENSDARG00000071745

Ensembl ID:
ENSDARG00000071745

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17665 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106318 Nonsense 218 298 5 6
Genomic Location:
Chromosome 12 (position 10005918)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTCTCTCAGGCACTCCWGCATACGCTCCTCCTGAGTGGTTTAGCAGA[C/T]AGCGCTATAAWGCCACTCCAGCTAYAGTGTGGTCAGTAGGAGTGACCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0a8c060h