si:dkey-20i20.2

Ensembl ID:
ENSDARG00000071719
ZFIN ID:
ZDB-GENE-060503-528
Description:
hypothetical protein LOC100126809 [Source:RefSeq peptide;Acc:NP_001104559]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29695 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106220 Nonsense 264 289 3 3
ENSDART00000106221   None 135 3 3
ENSDART00000140578   None 176 None 3
Genomic Location (Zv9):
Chromosome 22 (position 2106300)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2847390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCGTGTGATCGGTGCGGCAGGACATTTTTTAGGCCTTCGAACCTTCAG[A/T]AACATCTTCTAGTTCATGCAGAGGAGAAGACGCATTCATGCGCTCTGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link