si:dkey-20i20.5

Ensembl ID:
ENSDARG00000071714
ZFIN ID:
ZDB-GENE-060503-812
Description:
hypothetical protein LOC560276 [Source:RefSeq peptide;Acc:NP_001121715]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25174 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106237 Nonsense 671 715 6 6
ENSDART00000145463   None 195 None 2
Genomic Location (Zv9):
Chromosome 22 (position 2080864)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2821954
KASP Assay ID:
554-7471.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTATCAGTGCCTCGTGTGTGAAAAGAGCTTTCTTAGACCTGGAGCAT[T/A]GAAACAGCACCTGAAGATTCACACTGGAGAGAGACCACACAAATGTGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link