heatr1

Ensembl ID:
ENSDARG00000071707
ZFIN ID:
ZDB-GENE-030131-6378
Description:
HEAT repeat-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7SY48]
Human Orthologue:
HEATR1
Human Description:
HEAT repeat containing 1 [Source:HGNC Symbol;Acc:25517]
Mouse Orthologue:
Heatr1
Mouse Description:
HEAT repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442524]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10451 Essential Splice Site Available for shipment Available now
sa7687 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066446 Essential Splice Site 915 2159 21 45
ENSDART00000133233 Essential Splice Site 115 1279 3 25
ENSDART00000134463 None None 110 None 4
ENSDART00000144776 Essential Splice Site 115 1337 3 27
Genomic Location:
Chromosome 12 (position 10535923)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTCCACCATGACTAACATGCATCTCTCTCTATGTTTGTATATTTGC[A/G]GTGGTGCCGTCTCTGCTGGTGTGTGTATGTTCAGGCGTGTGTGAAGTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066446 Nonsense 1566 2159 34 45
ENSDART00000133233 Nonsense 766 1279 16 25
ENSDART00000134463 None None 110 None 4
ENSDART00000144776 Nonsense 766 1337 16 27
Genomic Location:
Chromosome 12 (position 10556091)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTTGGTGGAGGTTCTGCGCTACATTCAGGCAGTTGCTCGATGTGTC[G/T]AGGATAATGCAGATAAGCCAACAGCTAAGTTCWGGAGAGCCCTCCTAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5t6aiwok