heatr1

Ensembl ID:
ENSDARG00000071707
ZFIN ID:
ZDB-GENE-030131-6378
Description:
HEAT repeat-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7SY48]
Human Orthologue:
HEATR1
Human Description:
HEAT repeat containing 1 [Source:HGNC Symbol;Acc:25517]
Mouse Orthologue:
Heatr1
Mouse Description:
HEAT repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442524]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10451 Essential Splice Site Available for shipment Available now
sa27897 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066446 Essential Splice Site 915 2159 21 45
ENSDART00000133233 Essential Splice Site 115 1279 3 25
ENSDART00000134463   None 110 None 4
ENSDART00000144776 Essential Splice Site 115 1337 3 27
Genomic Location (Zv9):
Chromosome 12 (position 10535923)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9622636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTCCACCATGACTAACATGCATCTCTCTCTATGTTTGTATATTTGC[A/G]GTGGTGCCGTCTCTGCTGGTGTGTGTATGTTCAGGCGTGTGTGAAGTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066446 Essential Splice Site 1182 2159 25 45
ENSDART00000133233 Essential Splice Site 382 1279 7 25
ENSDART00000134463   None 110 None 4
ENSDART00000144776 Essential Splice Site 382 1337 7 27
Genomic Location (Zv9):
Chromosome 12 (position 10542098)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9616461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAAAGAGTTACTGCAACAGTTCAACAAACGCGCAGAAGTAAAATGAG[G/A]TGAGTGGTTGTACTTTCGTAGTACACCGCAAATATTCCAGTTCTAAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link