NDC80_DANRE

Ensembl ID:
ENSDARG00000071694
Description:
Kinetochore protein NDC80 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DRJ7]
Human Orthologue:
NDC80
Human Description:
NDC80 homolog, kinetochore complex component (S. cerevisiae) [Source:HGNC Symbol;Acc:16909]
Mouse Orthologue:
Ndc80
Mouse Description:
NDC80 homolog, kinetochore complex component (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914302

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22044 Nonsense Available for shipment Available now
sa41971 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14319 Essential Splice Site Available for shipment Available now
sa38875 Nonsense Mutation detected in F1 DNA During 2017
sa16762 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007335 Nonsense 156 632 5 17
ENSDART00000112640 Nonsense 156 608 5 18

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 11441918)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10324989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGCCTACTGCCAAAGTGGAGGAAGAGATCCCAAGAATGCTCAAAGATT[T/A]GGGGTAATCAATATTATTTTATCACTACACCCTGTACAATTTACAGTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007335 Essential Splice Site 221 632 7 17
ENSDART00000112640 Essential Splice Site 221 608 7 18
Genomic Location (Zv9):
Chromosome 12 (position 11439962)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10323033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTCAGATGAGCTGTGTGATTTAGAGGACCGAACAGAGTACAACAAGG[T/C]ATTCTATCAAACAACACCTCATCTTGTGCAGCACTTATTTTCTTATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007335 Essential Splice Site 513 632 14 17
ENSDART00000112640 Essential Splice Site 489 608 15 18
Genomic Location (Zv9):
Chromosome 12 (position 11433812)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10316883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAAGGAACAGATTCGCAAAGTCGACCAGCAGCTGGAGAATGCCATGCAGG[T/C]AAAATACACCTCCACRGGGCGTTTGGGTTTTAAATGTAATATTAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007335 Nonsense 557 632 15 17
ENSDART00000112640 Nonsense 533 608 16 18
Genomic Location (Zv9):
Chromosome 12 (position 11433285)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10316356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGCAGGGGATTGAGGAAGCTGAAGAGGAAGTCAAAGCTGCCCAACAA[C/T]AGTGAGAATCTCTTTTCCACTGTTTTTTTTTTTAATTCTGTTTCTTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007335 Nonsense 632 632 17 17
ENSDART00000112640 Nonsense 608 608 18 18
Genomic Location (Zv9):
Chromosome 12 (position 11432576)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10315647
KASP Assay ID:
2260-5040.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACCAGCTCACAGATCTGGWGGAAAACTTCATWAAGAAAGCCAACAGCT[T/A]GTAATGCTTRACTKTCCTGTTTTGTAAATACTKTTAYTATTAGACKAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link