si:ch211-278g15.1

Ensembl ID:
ENSDARG00000071692
ZFIN ID:
ZDB-GENE-091113-37
Human Orthologue:
PREX2
Human Description:
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 [Source:HGNC Symbol;Acc:229
Mouse Orthologue:
Prex2
Mouse Description:
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12110 Nonsense Available for shipment Available now
sa18614 Nonsense Available for shipment Available now
sa13066 Essential Splice Site Available for shipment Available now
sa6763 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37864 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24475 Nonsense Available for shipment Available now
sa15890 Nonsense Available for shipment Available now
sa24476 Essential Splice Site Available for shipment Available now
sa24477 Nonsense Available for shipment Available now
sa39442 Nonsense Mutation detected in F1 DNA During 2017
sa37865 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 17 1600 1 40
ENSDART00000106186 Nonsense 17 1600 1 40
Genomic Location (Zv9):
Chromosome 24 (position 19498296)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18804450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGACTGAGGAGAGCAAAGCCGAACACAGAGCCGAAAGTGGAAAAGATT[T/A]AGASAAGCAGCTTCGTTTGAGAGTTTGTGTTTTGAACGAACTTCTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 17 1600 1 40
ENSDART00000106186 Nonsense 17 1600 1 40
Genomic Location (Zv9):
Chromosome 24 (position 19498296)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18804450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGACTGAGGAGAGCAAAGCCGAACACAGAGCCGAAAGTGGAAAAGATT[T/A]AGASAAGCAGCTTCGTTTGAGAGTTTGTGTTTTGAACGAACTTCTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Essential Splice Site 46 1600 1 40
Genomic Location (Zv9):
Chromosome 24 (position 19498385)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18804539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTCTGAAGACCGAGCGGGATTATGTTGGGACGCTGGAGTTTCTTTCG[G/A]TAAGGGATTTTTYCTTTTCCTGTTTAGCANTTTTAYATGTACGTTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Essential Splice Site 111 1600 3 40
Genomic Location (Zv9):
Chromosome 24 (position 19541427)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18847581
KASP Assay ID:
554-4464.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTGACCCAAACCCCTATCATGAAGTGGGCCACTGCTTCCTGCACTTTG[T/C]GAGTCACTGTCTGATACGCTCTCTCTTCACTTACTGTATTACACTCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Essential Splice Site 412 1600 10 40
Genomic Location (Zv9):
Chromosome 24 (position 19572569)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18878723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGACCGCAAGCGAAAACTCACCACCTTCCCCAAGTGCTTCCTTGGAAG[G/A]TAGGTCAACAAAAGCTGGACCTCTGTGTGGATAATAGCTGTGGTAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 662 1600 18 40
Genomic Location (Zv9):
Chromosome 24 (position 19606202)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18912356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGACCTTTCCAGGAAGTAGAAAACTTTCTAAAGCAGTGCTTCCACAGC[A/T]GAGGTCCCATCAGAGTCCTGGTCAGCACCAAACCCAGAGAGTAAGTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 824 1600 22 40
Genomic Location (Zv9):
Chromosome 24 (position 19616660)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18922814
KASP Assay ID:
2261-8622.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTAACGGTGGATAACGWATATCTGGAGTACGGCGTCATGTATGAATA[C/A]GACAGCACAGCTGGCAYGAAGTGTYACRTCTTGGAGAAAATGGTRGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Essential Splice Site 1107 1600 26 40
Genomic Location (Zv9):
Chromosome 24 (position 19640569)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18946723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGGAGGACTCAGGTCATGACACCATCAGCAACCGGGACTCCTACAG[G/A]TAAATGTGCATACAGTGACCATACGTTTACTGTTAAATGGGGTGTCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 1185 1600 29 40
Genomic Location (Zv9):
Chromosome 24 (position 19649678)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18955832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCATCACTAGTTTGCTAAAAGGGGCAACCGTGACACGAGCTTTTGAA[C/T]AAACTAAATGCTTCACTCCAGGACGAGGACTTCAAGGTACTAAACCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 1193 1600 29 40
Genomic Location (Zv9):
Chromosome 24 (position 19649702)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18955856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCAACCGTGACACGAGCTTTTGAACAAACTAAATGCTTCACTCCAGGA[C/T]GAGGACTTCAAGGTACTAAACCTACTGACACACATGCACACAAACTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106186 Nonsense 1437 1600 35 40
Genomic Location (Zv9):
Chromosome 24 (position 19681149)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 18987303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGAGTATCAGGCTCAGATCAATGCGGGCTCTCTGGAGAAGGTCAAG[C/T]AGTACTACAAGAGACTCCGGTAAGCCTGATTCAGCTGTCAGTCAAACCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link