lonp1

Ensembl ID:
ENSDARG00000071674
ZFIN ID:
ZDB-GENE-030131-4006
Human Orthologue:
LONP1
Human Description:
lon peptidase 1, mitochondrial [Source:HGNC Symbol;Acc:9479]
Mouse Orthologue:
Lonp1
Mouse Description:
lon peptidase 1, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1921392]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4978 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43743 Nonsense Mutation detected in F1 DNA During 2016
sa39354 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106143 Essential Splice Site 606 966 12 18
Genomic Location:
Chromosome 22 (position 1235044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCKATAGATATGTCGAAATGACCAGACTGTATTCATCTCTTTGTTGCACA[G/T]GTTGACAAAATAGGTCGAGGATACCAGGGCGACCCTTCTTCGGCACTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106143 Nonsense 844 966 16 18
Genomic Location:
Chromosome 22 (position 1230420)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCGCTAAGATTGCGTACACGTTTGCTCGCTCGTTCCTCATGAAGGAG[C/T]AACCAGACAATGAGTTCCTCGTGAGCTCCCATATTCACCTCCATGTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106143 Essential Splice Site 862 966 17 18
Genomic Location:
Chromosome 22 (position 1230118)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATAGTGTTTTGAATGAGGGAAAGCCAGACTTAGGTTGTGTTTGTTTTC[A/T]GGGTGCGACTCCTAAAGACGGCCCCAGCGCCGGATGCACCATCGTCACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link