lonp1

Ensembl ID:
ENSDARG00000071674
ZFIN ID:
ZDB-GENE-030131-4006
Human Orthologue:
LONP1
Human Description:
lon peptidase 1, mitochondrial [Source:HGNC Symbol;Acc:9479]
Mouse Orthologue:
Lonp1
Mouse Description:
lon peptidase 1, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1921392]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43743 Nonsense Mutation detected in F1 DNA During 2016
sa39354 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106143 Nonsense 844 966 16 18
Genomic Location (Zv9):
Chromosome 22 (position 1230420)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3145013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCGCTAAGATTGCGTACACGTTTGCTCGCTCGTTCCTCATGAAGGAG[C/T]AACCAGACAATGAGTTCCTCGTGAGCTCCCATATTCACCTCCATGTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106143 Essential Splice Site 862 966 17 18
Genomic Location (Zv9):
Chromosome 22 (position 1230118)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3144711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATAGTGTTTTGAATGAGGGAAAGCCAGACTTAGGTTGTGTTTGTTTTC[A/T]GGGTGCGACTCCTAAAGACGGCCCCAGCGCCGGATGCACCATCGTCACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link