ctdspla

Ensembl ID:
ENSDARG00000071673
ZFIN ID:
ZDB-GENE-060825-333
Description:
small CTD phosphatase 3-like [Source:RefSeq peptide;Acc:NP_001038912]
Human Orthologue:
CTDSPL
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like [Source:HGNC
Mouse Orthologue:
Ctdspl
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like Gene [Source:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10650 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089428 Essential Splice Site 163 265 6 7
ENSDART00000089430 Essential Splice Site 118 220 5 6

The following transcripts of ENSDARG00000071673 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 21077560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYGGGTCAGTGTGGTCATCATGGTGTAATTGCTGCATTGTAWTGTTACA[G/A]TACGCTGACCCTGTAGCAGACCTGCTGGACCAGTGGGGGGTGTTCAGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: A genome-wide association study of breast and prostate cancer in the NHLBI's Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3x0xig3r