ywhag2

Ensembl ID:
ENSDARG00000071658
ZFIN ID:
ZDB-GENE-061023-2
Human Orthologue:
YWHAG
Human Description:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide [Source:HG
Mouse Orthologue:
Ywhag
Mouse Description:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide Gene [Sour

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12237 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106120 Nonsense 76 247 2 2
Genomic Location:
Chromosome 15 (position 14369626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGGAGGGTGATCTCCAGCATCGAGCAGAAGACCTCRGCAGACGGCAAC[G/T]AGAAGAAGATCGAGATGGTGAGGGCCTACCGGGAAAAGATCGAGAAGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ndzvanb5