si:ch73-256j6.2

Ensembl ID:
ENSDARG00000071653
ZFIN ID:
ZDB-GENE-070705-223
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WWL8]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3179 Nonsense F2 line generated During 2017
sa37418 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3179
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106174   None 159 None 2
ENSDART00000144103 Nonsense 29 339 1 4
Genomic Location (Zv9):
Chromosome 22 (position 4572190)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4546604
KASP Assay ID:
554-3077.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCACAGAAATAAAGGATGAGGATCAGATTCAGTGGCGGTTTGGATAT[G/T]AAGACAATAATGCAATCGCAGAAATCAACGTAACGGCTAACAGATTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106174   None 159 None 2
ENSDART00000144103 Nonsense 217 339 3 4
Genomic Location (Zv9):
Chromosome 22 (position 4570660)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4545074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGAACTCCGGTTTTACTCAAATGATGGATGATGATGAGGTTCAGTG[G/A]TTGTTTTCTAATGAAAACTTTCCAATAGCTGAAAGCATTAACAGGGACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link