si:ch211-213a13.5

Ensembl ID:
ENSDARG00000071618
ZFIN ID:
ZDB-GENE-050208-711
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LXX1]
Human Orthologues:
NLRP12, RNH1
Human Descriptions:
NLR family, pyrin domain containing 12 [Source:HGNC Symbol;Acc:22938]
ribonuclease/angiogenin inhibitor 1 [Source:HGNC Symbol;Acc:10074]
Mouse Orthologue:
Rnh1
Mouse Description:
ribonuclease/angiogenin inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1195456]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32373 Nonsense Available for shipment Available now
sa37423 Essential Splice Site Available for shipment Available now
sa44982 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106028 Nonsense 1253 1522 23 28
ENSDART00000145430 Nonsense 70 282 2 6
Genomic Location (Zv9):
Chromosome 22 (position 9097280)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9128356
GRCz11 22 9158038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAAGATCCATTTCTTGTGAGAGAGCTAAATCTGCGTGATCAAAAACTC[G/T]GAGACACAAACATCAAATATCTTGCTGCTCTGCTGCAGGATAAACACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106028 Essential Splice Site 1275 1522 23 28
ENSDART00000145430 Essential Splice Site 92 282 2 6
Genomic Location (Zv9):
Chromosome 22 (position 9097211)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9128287
GRCz11 22 9157969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTGCTGCTCTGCTGCAGGATAAACACTGTAAACTCAACACAATTCAG[T/A]GAGTATATTACAGGGATTACTAGTTAAATATTTTACCAGTGTAGCTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106028 Nonsense 1313 1522 24 28
ENSDART00000145430 Nonsense 130 282 3 6
Genomic Location (Zv9):
Chromosome 22 (position 9096435)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9127511
GRCz11 22 9157193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCATCACACCTGAGAGAACTGGACCTCAGTGAGAATCAAATTAAAAAC[A/T]GAGCAGTGAATCTCTTATGTGACGTACTGAAAGATTCACACTGTAAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link