si:ch211-213a13.5

Ensembl ID:
ENSDARG00000071618
ZFIN ID:
ZDB-GENE-050208-711
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LXX1]
Human Orthologues:
NLRP12, RNH1
Human Descriptions:
NLR family, pyrin domain containing 12 [Source:HGNC Symbol;Acc:22938]
ribonuclease/angiogenin inhibitor 1 [Source:HGNC Symbol;Acc:10074]
Mouse Orthologue:
Rnh1
Mouse Description:
ribonuclease/angiogenin inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1195456]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32373 Nonsense Available for shipment Available now
sa37423 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106028 Nonsense 1253 1522 23 28
ENSDART00000145430 Nonsense 70 282 2 6
Genomic Location (Zv9):
Chromosome 22 (position 9097280)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9128356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAAGATCCATTTCTTGTGAGAGAGCTAAATCTGCGTGATCAAAAACTC[G/T]GAGACACAAACATCAAATATCTTGCTGCTCTGCTGCAGGATAAACACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106028 Essential Splice Site 1275 1522 23 28
ENSDART00000145430 Essential Splice Site 92 282 2 6
Genomic Location (Zv9):
Chromosome 22 (position 9097211)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9128287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTGCTGCTCTGCTGCAGGATAAACACTGTAAACTCAACACAATTCAG[T/A]GAGTATATTACAGGGATTACTAGTTAAATATTTTACCAGTGTAGCTGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link