si:ch211-156p11.1

Ensembl ID:
ENSDARG00000071604
ZFIN ID:
ZDB-GENE-070912-120
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:A8HAM9]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43771 Nonsense Mutation detected in F1 DNA During 2017
sa13046 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105988 Nonsense 305 871 3 14
ENSDART00000141625 Nonsense 497 671 3 3
Genomic Location (Zv9):
Chromosome 22 (position 9154586)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9185662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACCCAGATCTTTAAGGAGGAAACAGGGATTGCTCTTGGTACCATGTA[C/A]TGCTTTGTTCACTTGAGCATTCAAGAGTTTATTGCAGCCATTTATGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105988 Nonsense 815 871 13 14
ENSDART00000141625   None 671 None 3
Genomic Location (Zv9):
Chromosome 22 (position 9164650)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9195726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAGCTGKAATGAACTAGSAGACTCTGGAGTGAMAAACCTCAGTGATT[T/A]ACTGATGAAGCCACAATTCARGCTGGAGAAACTACAGTTAGTATCATTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link