pvalb9

Ensembl ID:
ENSDARG00000071601
ZFIN ID:
ZDB-GENE-030805-4
Description:
parvalbumin 9 [Source:RefSeq peptide;Acc:NP_891983]
Human Orthologues:
OCM, OCM2
Human Descriptions:
oncomodulin 2 [Source:HGNC Symbol;Acc:34396]
oncomodulin [Source:HGNC Symbol;Acc:8105]
Mouse Orthologue:
Ocm
Mouse Description:
oncomodulin Gene [Source:MGI Symbol;Acc:MGI:97401]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa468 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105974 Nonsense 76 109 4 5

The following transcripts of ENSDARG00000071601 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 18764534)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17575111
KASP Assay ID:
554-0200.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGATTTGTGTGAATCAGGTTCTTTCTCCAGCGGTTTTTCCCGGGGGCA[C/T]GAACCCTGACAGAAAAGGAGATTAAGAGCCTCCTCACAGCTGCAGATGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link