neto1l

Ensembl ID:
ENSDARG00000071596
ZFIN ID:
ZDB-GENE-091207-1
Human Orthologue:
NETO1
Human Description:
neuropilin (NRP) and tolloid (TLL)-like 1 [Source:HGNC Symbol;Acc:13823]
Mouse Orthologue:
Neto1
Mouse Description:
neuropilin (NRP) and tolloid (TLL)-like 1 Gene [Source:MGI Symbol;Acc:MGI:2180216]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37848 Nonsense Mutation detected in F1 DNA During 2017
sa24467 Essential Splice Site Available for shipment Available now
sa11404 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105956 Nonsense 232 539 7 11
ENSDART00000133254   None 219 None 6
Genomic Location (Zv9):
Chromosome 24 (position 16007002)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15958450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTTCCTCGACTATGAGATGCAGAATTCGAACGAGTGCAAGCGTAATTA[T/A]GTGGCGGTGTATGACGGCAGCAGCTCGGTGGAGGACCTGAGGAATAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105956 Essential Splice Site 289 539 8 11
ENSDART00000133254   None 219 None 6
Genomic Location (Zv9):
Chromosome 24 (position 16015958)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15967406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGAAAAGTGAAGTGTAATGTGACATTATCCGTTTTTCCCTCTCATCA[G/A]CTCCCTGTGAGGCAGACACTTTCTTTTGCCACAGTAACATGTGTATCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105956 Nonsense 330 539 9 11
ENSDART00000133254   None 219 None 6
Genomic Location (Zv9):
Chromosome 24 (position 16025112)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15976560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTAACAATTCATCACCTTCCTGTTACTGTATATGTTTTCCAGAAAAGCGG[A/T]AAGCAAACAWTCTCGACAGCCTCAAMAACACCAATGGCAYCATCATCGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link