tgfbi

Ensembl ID:
ENSDARG00000071586
ZFIN ID:
ZDB-GENE-030131-73
Description:
transforming growth factor-beta-induced protein ig-h3 [Source:RefSeq peptide;Acc:NP_878282]
Human Orthologue:
TGFBI
Human Description:
transforming growth factor, beta-induced, 68kDa [Source:HGNC Symbol;Acc:11771]
Mouse Orthologue:
Tgfbi
Mouse Description:
transforming growth factor, beta induced Gene [Source:MGI Symbol;Acc:MGI:99959]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42397 Nonsense Mutation detected in F1 DNA During 2016
sa39002 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22487 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105933 Nonsense 443 677 10 17
ENSDART00000128463 Nonsense 456 690 10 17
Genomic Location:
Chromosome 14 (position 27529521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGAGAAACCACATTCTCAAGGAGAAGTTTTCCTCCAAGAGCCTTTA[T/A]CATGGGCAGGAGTTGGAGACCCTTGGTGGACTGAAACTTAGAGTGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105933 Essential Splice Site 553 677 12 17
ENSDART00000128463 Essential Splice Site 566 690 12 17
Genomic Location:
Chromosome 14 (position 27524379)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGCTGCTTTCAGTGCATTGCCGTCCGCTGACCTCAACAAACTCATGAG[T/A]AATGTCTCACCTTGTCAGTCAGTCAGAAAAGCAGACGTTTAGTGCATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105933 Essential Splice Site 628 677 14 17
ENSDART00000128463 Essential Splice Site 641 690 14 17
Genomic Location:
Chromosome 14 (position 27522010)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTACCAATGGAGTTGTGCACGCTGTTAATGTCATCATCAAGCCACTGC[G/A]TAAGCCAAGGATTCCTTAAACACTGTGATAAAAGAACTATATTGTTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link