prhoxnb

Ensembl ID:
ENSDARG00000071579
ZFIN ID:
ZDB-GENE-070112-472
Description:
2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase [Source:UniProtKB/Swiss-Prot;Acc:A1L259]
Human Orthologue:
PRHOXNB
Human Description:
parahox cluster neighbor [Source:HGNC Symbol;Acc:17785]
Mouse Orthologue:
Prhoxnb
Mouse Description:
parahox cluster neighbor Gene [Source:MGI Symbol;Acc:MGI:3647519]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10651 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105917 Nonsense 35 174 1 2
Genomic Location (Zv9):
Chromosome 24 (position 22296936)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21543814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTAATGTGGTTGAGAAATGCCCCCTCATCTCAGCCGCTATATGGWCCTA[T/A]CGACCATTTAAAGATCTAGCAGACATCGAGGCTCGCATATCGGAATTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link