ppp1cab

Ensembl ID:
ENSDARG00000071566
ZFIN ID:
ZDB-GENE-030131-5512
Description:
protein phosphatase 1, catalytic subunit, alpha-like [Source:RefSeq peptide;Acc:NP_997875]
Human Orthologues:
PPP1CA, PPP1CC
Human Descriptions:
protein phosphatase 1, catalytic subunit, alpha isozyme [Source:HGNC Symbol;Acc:9281]
protein phosphatase 1, catalytic subunit, gamma isozyme [Source:HGNC Symbol;Acc:9283]
Mouse Orthologues:
Ppp1ca, Ppp1cc
Mouse Descriptions:
protein phosphatase 1, catalytic subunit, alpha isoform Gene [Source:MGI Symbol;Acc:MGI:103016]
protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI Symbol;Acc:MGI:104872]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27914 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092906 Nonsense 78 332 3 7
Genomic Location (Zv9):
Chromosome 12 (position 14313700)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13169353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGTGATGTTCATGGTCAGTACTATGACCTGCTCAGGCTTTTTGAGTA[T/A]GGAGGATATCCACCAGAGAGTAACTACCTATTTCTGGGAGACTATGTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link