ecm2

Ensembl ID:
ENSDARG00000071549
ZFIN ID:
ZDB-GENE-050208-651
Description:
Novel protein similar to human extracellular matrix protein 2, female organ and adipocyte specific
Human Orthologue:
ECM2
Human Description:
extracellular matrix protein 2, female organ and adipocyte specific [Source:HGNC Symbol;Acc:3154]
Mouse Orthologue:
Ecm2
Mouse Description:
extracellular matrix protein 2, female organ and adipocyte specific Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25177 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105855 Nonsense 624 731 8 9
ENSDART00000136961 Nonsense 622 666 8 8
Genomic Location:
Chromosome 22 (position 10603641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCGCACACATGGAGCCTGGCCTGGAGTACCTCTACCTCTCTTACAAC[A/T]AGCTAGATGGTGACGGCGTCGAGCCAGAGTCCTTCTTTGGCACCCTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qfb0ne0p