ENSDARG00000071547

Ensembl ID:
ENSDARG00000071547
Human Orthologues:
SESN1, SESN2, SESN3
Human Descriptions:
sestrin 1 [Source:HGNC Symbol;Acc:21595]
sestrin 2 [Source:HGNC Symbol;Acc:20746]
sestrin 3 [Source:HGNC Symbol;Acc:23060]
Mouse Orthologues:
Sesn1, Sesn2, Sesn3
Mouse Descriptions:
sestrin 1 Gene [Source:MGI Symbol;Acc:MGI:2155278]
sestrin 2 Gene [Source:MGI Symbol;Acc:MGI:2651874]
sestrin 3 Gene [Source:MGI Symbol;Acc:MGI:1922997]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35710 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105853 Nonsense 260 444 4 8
Genomic Location (Zv9):
Chromosome 14 (position 31797731)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30587639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAACAAATTCATAAATCACAGGATGAAATCAAGGAAAGAAAGGGGGAC[C/T]GACTCCATTCACAGACGCTCCTACATTCAGGTAAGATGTTCACCCATGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link