insrb

Ensembl ID:
ENSDARG00000071524
ZFIN ID:
ZDB-GENE-020503-4
Description:
insulin receptor b [Source:RefSeq peptide;Acc:NP_001116701]
Human Orthologue:
INSR
Human Description:
insulin receptor [Source:HGNC Symbol;Acc:6091]
Mouse Orthologue:
Insr
Mouse Description:
insulin receptor Gene [Source:MGI Symbol;Acc:MGI:96575]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16909 Nonsense Available for shipment Available now
sa6697 Nonsense Mutation detected in F1 DNA During 2016
sa32383 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105823 Nonsense 310 1348 3 21
Genomic Location:
Chromosome 22 (position 11063496)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATACGTCATCCACAAYGGGGCCTGCATCCCAGAATGCCCRTCCGGATA[C/A]ACCACCGTCAACTCCACCTCGTACGTATCAATTTTCTCCTCAACAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105823 Nonsense 481 1348 7 21
Genomic Location:
Chromosome 22 (position 11049510)
KASP Assay ID:
554-4884.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATTKTTTAGCMRTAAAGTAGACCCGATCTKCATTCTGTCCTRCAGGT[G/T]AAAGTCACATACTCAAATTTACACAAATCCGCACCATGAGCGACAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105823 Nonsense 858 1348 12 21
Genomic Location:
Chromosome 22 (position 11041591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATCAGATGGAAAGAGCCCAAAACTCCTAACGGCATGATCATACTGTA[T/A]GAAGTCAAGTATCTACGGATGTCTGATAACTACGTAAGTGTTATAAATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link