insrb

Ensembl ID:
ENSDARG00000071524
ZFIN ID:
ZDB-GENE-020503-4
Description:
insulin receptor b [Source:RefSeq peptide;Acc:NP_001116701]
Human Orthologue:
INSR
Human Description:
insulin receptor [Source:HGNC Symbol;Acc:6091]
Mouse Orthologue:
Insr
Mouse Description:
insulin receptor Gene [Source:MGI Symbol;Acc:MGI:96575]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16909 Nonsense Available for shipment Available now
sa6697 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105823 Nonsense 310 1348 3 21
Genomic Location:
Chromosome 22 (position 11063496)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATACGTCATCCACAAYGGGGCCTGCATCCCAGAATGCCCRTCCGGATA[C/A]ACCACCGTCAACTCCACCTCGTACGTATCAATTTTCTCCTCAACAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105823 Nonsense 481 1348 7 21
Genomic Location:
Chromosome 22 (position 11049510)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATTKTTTAGCMRTAAAGTAGACCCGATCTKCATTCTGTCCTRCAGGT[G/T]AAAGTCACATACTCAAATTTACACAAATCCGCACCATGAGCGACAAGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q1mt8zef