si:ch73-78i5.3

Ensembl ID:
ENSDARG00000071518
ZFIN ID:
ZDB-GENE-070912-343
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B5RHZ2]
Human Orthologue:
KRT222
Human Description:
keratin 222 [Source:HGNC Symbol;Acc:28695]
Mouse Orthologue:
Krt222
Mouse Description:
keratin 222 Gene [Source:MGI Symbol;Acc:MGI:2442728]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37449 Nonsense Mutation detected in F1 DNA During 2017
sa3176 Nonsense F2 line generated During 2017
sa24098 Essential Splice Site Available for shipment Available now
sa15999 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105813 Nonsense 154 428 3 8
ENSDART00000129343 Nonsense 228 502 4 9
Genomic Location (Zv9):
Chromosome 22 (position 11834554)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11694722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAAGGCCTCGAAAGGATGCAGTCAGTCCCACAGTTGTGTTTCCGCCA[C/T]AGGTACGAATATCCAGCCTCTCTCTATTCATACTCTCTATGGTCTGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3176
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105813 Nonsense 180 428 4 8
ENSDART00000129343 Nonsense 254 502 5 9
Genomic Location (Zv9):
Chromosome 22 (position 11833399)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11693567
KASP Assay ID:
554-3023.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGCACGAGCCGAGCTCGCCGAGGCCCGAAAGCGATGGCACCGTCTA[C/T]AAGTGGAGATAGAATCGCTACATGCCTTGGTGTGTTTAACTCCCAAACRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105813 Essential Splice Site 358 428 None 8
ENSDART00000129343 Essential Splice Site 432 502 None 9
Genomic Location (Zv9):
Chromosome 22 (position 11830332)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11690500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAATTTGTTTATGGAAAACTATCTTATGCTTTGCATTCTGTTTGCTAT[A/G]GGACAGAGAAGATAGACAAGGTCATCAGGCAATGGGAAGGGTCATTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105813 Nonsense 402 428 8 8
ENSDART00000129343 Nonsense 476 502 9 9
Genomic Location (Zv9):
Chromosome 22 (position 11830200)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11690368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTCTGCKTTTTGACCTTCACATGGCAGTRGCGGACGAGGGCTGCAGC[C/T]AGATAAAACAGGACAGTCTCCCRAATGTGGAGGTCCGTCTTGTCATGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link