GLD2_DANRE

Ensembl ID:
ENSDARG00000071511
Description:
Poly(A) RNA polymerase GLD2 [Source:UniProtKB/Swiss-Prot;Acc:Q503I9]
Human Orthologue:
PAPD4
Human Description:
PAP associated domain containing 4 [Source:HGNC Symbol;Acc:26776]
Mouse Orthologue:
Papd4
Mouse Description:
PAP associated domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2140950]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7005 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105796 Essential Splice Site 41 489 2 15
Genomic Location (Zv9):
Chromosome 5 (position 53911990)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51187523
KASP Assay ID:
554-4765.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAATGTGTCCCAGCAACAAAGAATTGAAGCCCATCTGAATTCAACCAA[G/A]TGAGTATATATTTAAAAGACRATGTGCTTAAATTCTTTGTATTCARTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link