mgat5

Ensembl ID:
ENSDARG00000071506
ZFIN ID:
ZDB-GENE-060616-238
Description:
alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A [Source:RefSeq peptide;Acc:
Human Orthologue:
MGAT5
Human Description:
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase [Source:HGNC Symbol;Acc
Mouse Orthologue:
Mgat5
Mouse Description:
mannoside acetylglucosaminyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:894701]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13731 Nonsense Available for shipment Available now
sa24101 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19281 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa7979 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa17972 Essential Splice Site Available for shipment Available now
sa10529 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Nonsense 47 742 2 17
Genomic Location:
Chromosome 22 (position 12105976)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAKTTCACCATCCAGCAGAGGGCGACGCATGAAAGCAGCGYGCAGCTA[C/T]GAAWGCAGAYACTGGACCTTAGCAAGCGAWACATTAAAGCCCTTGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Essential Splice Site 270 742 7 17
Genomic Location:
Chromosome 22 (position 12160256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGCTCACTTGCCAACAAACAAAACCTCCACCACCGCAAACGCAAGAAG[G/A]TGAGGCTAAACATAAAACTGTGTAAAAAAAAAATCATCATCTATGGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
Genomic Location:
Chromosome 22 (position 12165244)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGCCTGGCGCAGTTCAAGAAGACCCTCGGCCCGTCCTGGGTCCATTA[T/A]CAGTAAGTGCAGAAATGTTTTAGTTATGAGCCCGCGGATGTGAGCGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
ENSDART00000105788 Splice Site, Nonsense 371 742 9 17
Genomic Location:
Chromosome 22 (position 12165244)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGCCTGGCGCAGTTCAAGAAGACCCTCGGCCCRTCCTGGGTCCATTA[T/A]CAGTAAGTGCAGAAATGTTTTAGTTATGAGCCCGCGGATGTGAGCGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Essential Splice Site 372 742 10 17
Genomic Location:
Chromosome 22 (position 12167875)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCATATTTCTCGTCCTCATCTGGTGTTGTCGGCCTCTGTTGCGTTTT[A/C]GGTGWATGCTGCGTGTGCTGGACTCATTCGGGACGGAGCCRGAGTTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105788 Nonsense 373 742 10 17
Genomic Location:
Chromosome 22 (position 12167880)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATTTCTCGTCCTCATCTGGTGTTGTCGGCCTCTGTTGCGTTTTAGGTG[T/A]ATGCTGCGTGTGCTGGACTCATTCGGGACGGAGCCRGAGTTCAATCACGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ziow5bgv