fshr

Ensembl ID:
ENSDARG00000071494
ZFIN ID:
ZDB-GENE-020423-5
Description:
follicle-stimulating hormone receptor [Source:RefSeq peptide;Acc:NP_001001812]
Human Orthologue:
FSHR
Human Description:
follicle stimulating hormone receptor [Source:HGNC Symbol;Acc:3969]
Mouse Orthologue:
Fshr
Mouse Description:
follicle stimulating hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95583]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13419 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105751 Essential Splice Site 206 668 7 10
Genomic Location:
Chromosome 12 (position 26269769)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGTGAGATAGACAGCCATGCATTCAATGGTACCAAAATTGGAAAACWG[T/G]GAGTGGTTACATCTKTTATATATTTATAAATCACATAAAAYCTCTAATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zmkslyw6