lrrc33

Ensembl ID:
ENSDARG00000071491
ZFIN ID:
ZDB-GENE-040808-36
Description:
Leucine-rich repeat-containing protein 33 [Source:UniProtKB/Swiss-Prot;Acc:Q6AXL3]
Human Orthologue:
LRRC33
Human Description:
leucine rich repeat containing 33 [Source:HGNC Symbol;Acc:24613]
Mouse Orthologue:
Lrrc33
Mouse Description:
leucine rich repeat containing 33 Gene [Source:MGI Symbol;Acc:MGI:2445095]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19342 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105749 Nonsense 441 685 3 3
Genomic Location:
Chromosome 24 (position 29334381)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAATCTTAACACACTAGATCTCAGTCACAACACTGTGGATGTGTGTTA[T/A]TCGTCAAACTACATTGGTTTATCAGGATGTGTCGAGTGGTCCAGTATGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m57j1u2m