AGL (3 of 3)

Ensembl ID:
ENSDARG00000071488
Description:
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase [Source:HGNC Symbol;Acc:321]
Human Orthologue:
AGL
Human Description:
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase [Source:HGNC Symbol;Acc:321]
Mouse Orthologue:
Agl
Mouse Description:
amylo-1,6-glucosidase, 4-alpha-glucanotransferase Gene [Source:MGI Symbol;Acc:MGI:1924809]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16698 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105741 Nonsense 411 478 10 11
Genomic Location:
Chromosome 24 (position 30769900)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAACATTTCTTTCTTACAGGCTATAGACTGCATTGTGGGAACAKTCTG[T/A]TATGAAAGAATTGCTGCCCACGGTCCTCWGCTTGGACCTGTAACTCAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fejfx0a7