aox3

Ensembl ID:
ENSDARG00000071475
ZFIN ID:
ZDB-GENE-001205-2
Description:
Novel protein similar to vertebrate xanthine dehydrogenase (XDH) [Source:UniProtKB/TrEMBL;Acc:Q1LW04
Human Orthologue:
AOX1
Human Description:
aldehyde oxidase 1 [Source:HGNC Symbol;Acc:553]
Mouse Orthologues:
Aox1, Aox3, Aox3l1, Aox4
Mouse Descriptions:
aldehyde oxidase 1 Gene [Source:MGI Symbol;Acc:MGI:88035]
aldehyde oxidase 3 Gene [Source:MGI Symbol;Acc:MGI:1918974]
aldehyde oxidase 3-like 1 Gene [Source:MGI Symbol;Acc:MGI:3529596]
aldehyde oxidase 4 Gene [Source:MGI Symbol;Acc:MGI:1919122]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37465 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43795 Nonsense Mutation detected in F1 DNA During 2016
sa39364 Nonsense Mutation detected in F1 DNA During 2016
sa37464 Essential Splice Site Mutation detected in F1 DNA During 2016
sa574 Nonsense Available for shipment Available now
sa37463 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18330 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105717 Essential Splice Site 62 1241 3 32

The following transcripts of ENSDARG00000071475 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 14257185)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14088293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGCACTGTGATGGTGTCCAGATATGACCCTCTCCAGGACACCGTGCT[G/A]TATCTTTCACCAATACATCAAACAAGCAGCATTAAAGCTTTAAATGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105717 Nonsense 220 1241 8 32

The following transcripts of ENSDARG00000071475 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 14253529)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14084637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGGTCAGGTGGATTTCACCATCAGATCTAAAAGATTTAATCAAGCTG[A/T]AAGCTGAACACTCTGACGCACCTCTGTTGGTTGGAAACACAACCATAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105717 Nonsense 339 1241 11 32

The following transcripts of ENSDARG00000071475 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 14252574)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14083682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTTGTCTAAGTGAGGAGTTTTTCACAGACTTTGGAAAAACAGCTCTA[C/T]GACCTGAGGAGATTCTGCTGGCTATTGACATTCCTCATTCAAAGCCGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105717 Essential Splice Site 527 1241 14 32

The following transcripts of ENSDARG00000071475 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 14250067)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14081175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTGTTTGTTTCCATGGTAACCAGCACCCGGGCTCATGCAAAGATCAT[G/A]TAAGTTGAAAGATGTTCATTACAGATACATTTTTTTTTTCGCCCAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105717 Nonsense 670 1241 18 32

The following transcripts of ENSDARG00000071475 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 14236357)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14067465
KASP Assay ID:
554-0484.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACATGGAAACTCAGGGAGTGATTGCAATTCCTACAGGAGAAGCAAGT[G/T]AAATTGAGCTATATGTTGCCAGTCAGCATGCAGCTTACACTCAGGTTTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105717 Essential Splice Site 729 1241 19 32

The following transcripts of ENSDARG00000071475 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 14236057)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14067165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATGAAGATTGCATCATTATCTGCTATCGCTGCTACGGCTGCCATAAA[G/A]TAAATCAAACTAAGACCCTTACCTTTTTTACAGAATCGTTTCATTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105717 Essential Splice Site 758 1241 20 32

The following transcripts of ENSDARG00000071475 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 14235788)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14066896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACATGCTCATCACCAGTGGAAGATCTCCTTTCTTGGGGARGTACAAG[G/A]TAATGAGATGTTATGAGTGATATYTGTGATTGAACAGCTGTGCTGCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Intelligence: Genome-wide association study of intelligence: additive effects of novel brain expressed genes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link