aox3

Ensembl ID:
ENSDARG00000071475
ZFIN ID:
ZDB-GENE-001205-2
Description:
Novel protein similar to vertebrate xanthine dehydrogenase (XDH) [Source:UniProtKB/TrEMBL;Acc:Q1LW04
Human Orthologue:
AOX1
Human Description:
aldehyde oxidase 1 [Source:HGNC Symbol;Acc:553]
Mouse Orthologues:
Aox1, Aox3, Aox3l1, Aox4
Mouse Descriptions:
aldehyde oxidase 1 Gene [Source:MGI Symbol;Acc:MGI:88035]
aldehyde oxidase 3 Gene [Source:MGI Symbol;Acc:MGI:1918974]
aldehyde oxidase 3-like 1 Gene [Source:MGI Symbol;Acc:MGI:3529596]
aldehyde oxidase 4 Gene [Source:MGI Symbol;Acc:MGI:1919122]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa574 Nonsense Available for shipment Available now
sa18330 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105717 Nonsense 670 1241 18 32

The following transcripts of ENSDARG00000071475 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 14236357)
KASP Assay ID:
554-0484.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACATGGAAACTCAGGGAGTGATTGCAATTCCTACAGGAGAAGCAAGT[G/T]AAATTGAGCTATATGTTGCCAGTCAGCATGCAGCTTACACTCAGGTTTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa18330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105717 Essential Splice Site 758 1241 20 32

The following transcripts of ENSDARG00000071475 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 14235788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACATGCTCATCACCAGTGGAAGATCTCCTTTCTTGGGGARGTACAAG[G/A]TAATGAGATGTTATGAGTGATATYTGTGATTGAACAGCTGTGCTGCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Intelligence: Genome-wide association study of intelligence: additive effects of novel brain expressed genes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zxh0jms7