si:dkey-121a11.3

Ensembl ID:
ENSDARG00000071458
ZFIN ID:
ZDB-GENE-050208-417
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5PME5]
Human Orthologue:
KIAA1614
Human Description:
KIAA1614 [Source:HGNC Symbol;Acc:29327]
Mouse Orthologue:
BC034090
Mouse Description:
cDNA sequence BC034090 Gene [Source:MGI Symbol;Acc:MGI:2672904]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24132 Nonsense Available for shipment Available now
sa37481 Nonsense Mutation detected in F1 DNA During 2017
sa24133 Essential Splice Site, Missense Available for shipment Available now
sa10557 Nonsense Available for shipment Available now
sa24134 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105667 Nonsense 114 1060 1 9
ENSDART00000136458 Nonsense 114 130 2 2
ENSDART00000142454   None 747 None 7
Genomic Location (Zv9):
Chromosome 22 (position 16676222)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16427980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTGGGGCTCCAGCAGCAGCGATGAAGACGGTGAACCTCGCAAACCCT[T/A]GATGTTCCTCACCCGAGACTCCAATCCAGAACTTGAATATGATCCCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105667 Nonsense 590 1060 4 9
ENSDART00000136458   None 130 None 2
ENSDART00000142454 Nonsense 293 747 3 7
Genomic Location (Zv9):
Chromosome 22 (position 16686192)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16437950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACATTTCAGAAGCTAAAGAAGAAGGTTCGAAAATTTGACAGCAAGCGG[G/T]AATCTTTGTATGTAAATGGCCTCAGGACTCCATCACCTCTGGACTGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105667 Essential Splice Site 897 1060 6 9
ENSDART00000136458   None 130 None 2
ENSDART00000142454 Missense 601 747 5 7
Genomic Location (Zv9):
Chromosome 22 (position 16690264)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16442022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACCACCACCAGCTGAAGAAAGCCCCGTCACTGCAGACGATACGACTG[G/T]TTAGCATCTGCCTTAAAATTGGATATGTCTGTTTACATGCTACTAATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105667   None 1060 None 9
ENSDART00000136458   None 130 None 2
ENSDART00000142454 Nonsense 609 747 5 7
Genomic Location (Zv9):
Chromosome 22 (position 16690290)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16442048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTCACTGCAGACGATACGACTGGTTAGCATCTGCCTTAAAATTGKATA[T/A]GTCTGTTTACATGCWACTAATGAACTGTTGGTAGATCATGATGATARTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105667 Essential Splice Site 939 1060 7 9
ENSDART00000136458   None 130 None 2
ENSDART00000142454   None 747 None 7
Genomic Location (Zv9):
Chromosome 22 (position 16690502)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16442260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTGCATACACTCCAGGAGAACAACCTTGTAGTCCTGTATTAACCAG[G/A]TACATATTTTATACATTATATAAATTATTAACACTTTGATTTGGTTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link