si:ch211-234p6.14

Ensembl ID:
ENSDARG00000071454
ZFIN ID:
ZDB-GENE-060503-314
Description:
Novel pentaxin family domain containing protein [Source:UniProtKB/TrEMBL;Acc:A3KPG7]
Human Orthologues:
APCS, CRP
Human Descriptions:
amyloid P component, serum [Source:HGNC Symbol;Acc:584]
C-reactive protein, pentraxin-related [Source:HGNC Symbol;Acc:2367]
Mouse Orthologues:
1810030J14Rik, Apcs, Crp, Gm11062
Mouse Descriptions:
C-reactive protein, pentraxin-related Gene [Source:MGI Symbol;Acc:MGI:88512]
predicted gene 11062 Gene [Source:MGI Symbol;Acc:MGI:3779286]
RIKEN cDNA 1810030J14 gene Gene [Source:MGI Symbol;Acc:MGI:1913539]
serum amyloid P-component Gene [Source:MGI Symbol;Acc:MGI:98229]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15702 Nonsense Available for shipment Available now
sa3267 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105662 Nonsense 74 225 2 2
Genomic Location (Zv9):
Chromosome 24 (position 39576695)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38185784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGGCCACAGAGCTCCARGGMGAGCGGCAGATCATCCTGTTYGCCTAC[C/T]GAACAYCCGACTTTGATGAACTGAAYTTGTGGAGRGAGAAAGAMGGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105662 Nonsense 159 225 2 2
Genomic Location (Zv9):
Chromosome 24 (position 39576440)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38185529
KASP Assay ID:
554-3037.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACAGCATCCGCCCGCAGGGCACTGCTCTGCTYGGACAGGACCCTGAT[A/T]AACTCCTGGGCGACTTCGAGACGGTGCAGAGTTTCGCCGGTGAACTCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • C-reactive protein: C-reactive protein (CRP) promoter polymorphisms influence circulating CRP levels in a genome-wide association study of African Americans. (View Study)
  • C-reactive protein: Genetic Loci associated with C-reactive protein levels and risk of coronary heart disease. (View Study)
  • C-reactive protein: Genome-wide association and population genetic analysis of C-reactive protein in African American and Hispanic American women. (View Study)
  • C-reactive protein: Genome-wide association study for C-reactive protein levels identified pleiotropic associations in the IL6 locus. (View Study)
  • C-reactive protein: Genome-wide association with C-reactive protein levels in CLHNS: evidence for the CRP and HNF1A loci and their interaction with exposure to a pathogenic environment. (View Study)
  • C-reactive protein: Loci related to metabolic-syndrome pathways including LEPR,HNF1A, IL6R, and GCKR associate with plasma C-reactive protein: the Women's Genome Health Study. (View Study)
  • C-reactive protein: Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (View Study)
  • C-reactive protein: Polymorphisms of the HNF1A gene encoding hepatocyte nuclear factor-1 alpha are associated with C-reactive protein. (View Study)
  • Inflammatory biomarkers: A genome-wide association scan on the levels of markers of inflammation in Sardinians reveals associations that underpin its complex regulation. (View Study)
  • Lung cancer: Genome-wide association scan of tag SNPs identifies a susceptibility locus for lung cancer at 15q25.1. (View Study)
  • Metabolic traits: Genome-wide association analysis of metabolic traits in a birth cohort from a founder population. (View Study)
  • Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)
  • Select biomarker traits: Genome-wide association with select biomarker traits in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link