si:dkey-161j23.8

Ensembl ID:
ENSDARG00000071449
ZFIN ID:
ZDB-GENE-091204-17
Human Orthologue:
ITFG3
Human Description:
integrin alpha FG-GAP repeat containing 3 [Source:HGNC Symbol;Acc:14163]
Mouse Orthologue:
Itfg3
Mouse Description:
integrin alpha FG-GAP repeat containing 3 Gene [Source:MGI Symbol;Acc:MGI:2146854]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24560 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105646 Nonsense 61 546 1 11
ENSDART00000142522 Nonsense 81 504 2 12

The following transcripts of ENSDARG00000071449 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 41206002)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39745196
KASP Assay ID:
2261-9093.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGTTCCTGCTCTCCATCTTCCTGTGTCTGGCAGTCATCTTCGCCTTTT[C/A]ATTCATCCTCCCCTGCCCCGTACGGCCTCAATATGTGTCCACATGGAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link