A8E7R8_DANRE

Ensembl ID:
ENSDARG00000071448
Description:
Novel protein similar to vertebrate leprecan-like 1 (LEPREL1) [Source:UniProtKB/TrEMBL;Acc:A8E7R8]
Human Orthologue:
LEPREL1
Human Description:
leprecan-like 1 [Source:HGNC Symbol;Acc:19317]
Mouse Orthologue:
Leprel1
Mouse Description:
leprecan-like 1 Gene [Source:MGI Symbol;Acc:MGI:2146663]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43842 Essential Splice Site Mutation detected in F1 DNA During 2016
sa4170 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089827 Essential Splice Site 337 678 5 15
Genomic Location:
Chromosome 22 (position 23348184)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGAGTTTTACAGAGAGGTGCTAGGACATGATGGCCAGCCACGTAAGG[T/C]GAGAAACATGGAAGGAGTCACCCAAAACCAAATGATTTCTCATGAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089827 Essential Splice Site 381 678 7 15
Genomic Location:
Chromosome 22 (position 23339288)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTTCAGAGCTACTGGAGCAGTTCAGGTGGTAGAGAAGATGCGAACAG[G/A]TAGGAGTACTCAAAATATGAATATACAWTTGAAGTCAGATTTATTAGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link