A8E7R8_DANRE

Ensembl ID:
ENSDARG00000071448
Description:
Novel protein similar to vertebrate leprecan-like 1 (LEPREL1) [Source:UniProtKB/TrEMBL;Acc:A8E7R8]
Human Orthologue:
LEPREL1
Human Description:
leprecan-like 1 [Source:HGNC Symbol;Acc:19317]
Mouse Orthologue:
Leprel1
Mouse Description:
leprecan-like 1 Gene [Source:MGI Symbol;Acc:MGI:2146663]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43842 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089827 Essential Splice Site 337 678 5 15
Genomic Location (Zv9):
Chromosome 22 (position 23348184)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24433672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGAGTTTTACAGAGAGGTGCTAGGACATGATGGCCAGCCACGTAAGG[T/C]GAGAAACATGGAAGGAGTCACCCAAAACCAAATGATTTCTCATGAATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link