myoz1b

Ensembl ID:
ENSDARG00000071445
ZFIN ID:
ZDB-GENE-040718-146
Description:
myozenin 1 [Source:RefSeq peptide;Acc:NP_001002447]
Human Orthologue:
MYOZ1
Human Description:
myozenin 1 [Source:HGNC Symbol;Acc:13752]
Mouse Orthologue:
Myoz1
Mouse Description:
myozenin 1 Gene [Source:MGI Symbol;Acc:MGI:1929471]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1151 Essential Splice Site Available for shipment Available now
sa13506 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105636 Essential Splice Site 30 250 3 6
ENSDART00000124012 Essential Splice Site 30 250 3 6
ENSDART00000131896 Essential Splice Site 30 243 3 6
Genomic Location:
Chromosome 12 (position 27960832)
KASP Assay ID:
554-1062.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTAGGTGATCATTCTGAAGAAAATTTCCCTTTTATCTAATCTTCAGCA[G/A]ACCAGGAAGATGAGAATGCTGAAGCCTCTGAACTGGATTTGGGAACCAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105636 Nonsense 209 250 6 6
ENSDART00000124012 Nonsense 209 250 6 6
ENSDART00000131896 Nonsense 209 243 6 6
Genomic Location:
Chromosome 12 (position 27956763)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGAGATCAAGAAAACCAACRAGGAGCCGCAGCCAGTGKCTCTATCA[C/T]AGTATAATATTTGCTGTAGGCCTTCTTTCAACCGTACTCCAATCGGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q8ljc6x1