aspm

Ensembl ID:
ENSDARG00000071442
ZFIN ID:
ZDB-GENE-050208-620
Description:
asp (abnormal spindle)-like, microcephaly associated [Source:RefSeq peptide;Acc:NP_001116845]
Human Orthologue:
ASPM
Human Description:
asp (abnormal spindle) homolog, microcephaly associated (Drosophila) [Source:HGNC Symbol;Acc:19048]
Mouse Orthologue:
Aspm
Mouse Description:
asp (abnormal spindle)-like, microcephaly associated (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There are 19 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24172 Nonsense Available for shipment Available now
sa447 Essential Splice Site Confirmed mutation in F2 line During 2016
sa12763 Nonsense Available for shipment Available now
sa37518 Nonsense Available for shipment Available now
sa17838 Nonsense Available for shipment Available now
sa24171 Essential Splice Site Available for shipment Available now
sa43849 Nonsense Mutation detected in F1 DNA During 2016
sa43848 Nonsense Mutation detected in F1 DNA During 2016
sa43847 Nonsense Mutation detected in F1 DNA During 2016
sa1008 Nonsense Available for shipment Available now
sa9075 Nonsense Mutation detected in F1 DNA During 2016
sa24170 Nonsense Available for shipment Available now
sa37517 Nonsense Mutation detected in F1 DNA During 2016
sa24169 Nonsense Available for shipment Available now
sa11648 Nonsense Available for shipment Available now
sa13529 Nonsense Available for shipment Available now
sa5003 Essential Splice Site F2 line generated During 2016
sa6712 Nonsense Mutation detected in F1 DNA During 2016
sa37516 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 91 3411 1 30
ENSDART00000126795 Nonsense 91 3391 1 29
Genomic Location (Zv9):
Chromosome 22 (position 24352033)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23520711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGTCATTGTGGATAAAATCTCAGCATCCAAGGGCTTTTCGGTGGAT[C/T]AAATGTCGTTCACAATACAGGTAATAGCAAATATACAAATGATTATGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa447
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Essential Splice Site 97 3411 1 30
ENSDART00000126795 Essential Splice Site 97 3391 1 29
Genomic Location (Zv9):
Chromosome 22 (position 24352012)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23520732
KASP Assay ID:
554-0325.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAGCATCCAAGGGCTTTTCGGTGGATCAAATGTCGTTCACAATACAG[G/T]TAATAGCAAATATACAAATGATTATGTGTCATAAATGTGTAAATATGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 509 3411 3 30
ENSDART00000126795 Nonsense 509 3391 3 29
Genomic Location (Zv9):
Chromosome 22 (position 24348535)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23524209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGAATCGAAAATTTGTCCAGTTGCAAAAAAGAAGYCAACTTYAAATT[T/A]ATCCCCTCATGACCAACTTTTGTCCTCTATTTCTCCCATACGACCTMAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 657 3411 5 30
ENSDART00000126795 Nonsense 637 3391 4 29
Genomic Location (Zv9):
Chromosome 22 (position 24347509)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23525235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCACTGATGTAGATGCTCGGTCTGTGAAGTCAGCCAATAGCTCAACT[C/T]GAAAGACTGCGAGGATAGTAGCTGTGGCACAGGCCAGACTGACCTTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 697 3411 6 30
ENSDART00000126795 Nonsense 677 3391 5 29
Genomic Location (Zv9):
Chromosome 22 (position 24347310)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23525434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCAAGGCATCCATTGCCATTTGCGGCAAAAAACATGTTTTATGATGAG[C/T]GATGGATCGAAAAGCAAGAGCGAGGCTTTACTTGGTGGATGAACTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Essential Splice Site 829 3411 8 30
ENSDART00000126795 Essential Splice Site 809 3391 7 29
Genomic Location (Zv9):
Chromosome 22 (position 24345208)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23527536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACTGGCTCATATCGTACAATCCACTTTGGCTGCGAATTGGACTTGAG[G/A]TATTTACTTTTCATTGTAAAAGCATACTGTTTGTCTCATCACTTGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1194 3411 15 30
ENSDART00000126795 Nonsense 1174 3391 14 29
Genomic Location (Zv9):
Chromosome 22 (position 24338919)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23533825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACTCCTCCAGTGACTCGGATTGCTCTTTTGAAAATTTGGCCACAATG[C/T]AGTCTGGTAAGTTGAGTTGAGTTGCCCAAAGTTATGTTGGCTTCTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1716 3411 19 30
ENSDART00000126795 Nonsense 1696 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24333107)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23539637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCACTATATGCGATTGAGAAAGGCAACTATAACCATGCAGGCCATATA[T/A]CGGGGTTCCAAAGTGAGGCAGAATTTAAAAAGAGAACATCAAGCTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1809 3411 19 30
ENSDART00000126795 Nonsense 1789 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24332830)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23539914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAGTTCGCAACTACTTACGAAAATCTCACCAAGCTGCAAAAGTGATT[C/T]AGGCACATTTCCGTGGACATTCCCAACTCAAAAAGTACCGGAGACAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24332755)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23539989
KASP Assay ID:
554-0912.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAA[C/T]GATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCAATATGCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24332755)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23539989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAA[C/T]GATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCRATATGCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2161 3411 19 30
ENSDART00000126795 Nonsense 2141 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24331774)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23540970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGA[C/T]AGGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2309 3411 19 30
ENSDART00000126795 Nonsense 2289 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24331329)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23541415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTTAATTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGGCACACGT[T/A]GAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTGAGAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2314 3411 19 30
ENSDART00000126795 Nonsense 2294 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24331315)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23541429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCCTATCGTGGCATGAAGACCAGGCACACGTTGAAGCAAATGCAC[C/T]AAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2382 3411 19 30
ENSDART00000126795 Nonsense 2362 3391 18 29
Genomic Location (Zv9):
Chromosome 22 (position 24331110)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23541634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTTGAWTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGACAAACTT[T/G]AAAACAAATGCACCAGGCTGCCACCATTGTWCAGGCAACTTACCGAKCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2806 3411 20 30
ENSDART00000126795 Nonsense 2786 3391 19 29
Genomic Location (Zv9):
Chromosome 22 (position 24329729)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23543015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGGAAGGCCAAACTTTTTTCCCCCTTGCTATCAAACAGGCAAATTAT[C/T]GAGGGATGRTTGAGAGACGCAGGTTTCACCAACTCAAGGAGTGTGCWTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5003
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Essential Splice Site 2908 3411 21 30
ENSDART00000126795 Essential Splice Site 2888 3391 20 29
Genomic Location (Zv9):
Chromosome 22 (position 24329296)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23543448
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAKTGCCACCATTCGAAGATGTATCCAAGCGAGACGCCAACGCTCTAAG[T/A]AAGAAATTAAAGATATTATTTTGTTTATTMATTTTTTTGCTTTGTGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 3089 3411 25 30
ENSDART00000126795 Nonsense 3069 3391 24 29
Genomic Location (Zv9):
Chromosome 22 (position 24322014)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23550730
KASP Assay ID:
554-4098.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATCTTTCTTTCCCCCRAMTTTCCAGCAATGTTTTAGGGCAAAACTG[C/T]AGAGAAAGRAATATCTRAAAGACAGAGAAGACATCATCAAGACCCAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 3111 3411 25 30
ENSDART00000126795 Nonsense 3091 3391 24 29
Genomic Location (Zv9):
Chromosome 22 (position 24321947)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23550797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGACAGAGAAGACATCATCAAGACCCAGAGAGCAGTGAGATCTTGGT[T/A]ACATCGCCGCAACCAGGCTGCCTCTATTATCCAGCACGCAGTCAGGAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link