aspm

Ensembl ID:
ENSDARG00000071442
ZFIN ID:
ZDB-GENE-050208-620
Description:
asp (abnormal spindle)-like, microcephaly associated [Source:RefSeq peptide;Acc:NP_001116845]
Human Orthologue:
ASPM
Human Description:
asp (abnormal spindle) homolog, microcephaly associated (Drosophila) [Source:HGNC Symbol;Acc:19048]
Mouse Orthologue:
Aspm
Mouse Description:
asp (abnormal spindle)-like, microcephaly associated (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24172 Nonsense Mutation detected in F1 DNA During 2014
sa447 Essential Splice Site Confirmed mutation in F2 line During 2014
sa12763 Nonsense Available for shipment Available now
sa17838 Nonsense Available for shipment Available now
sa24171 Essential Splice Site Available for shipment Available now
sa3204 Nonsense Mutation detected in F1 DNA During 2014
sa9075 Nonsense Mutation detected in F1 DNA During 2014
sa1008 Nonsense Available for shipment Available now
sa5004 Nonsense Mutation detected in F1 DNA During 2014
sa24170 Nonsense Mutation detected in F1 DNA During 2014
sa24169 Nonsense Mutation detected in F1 DNA During 2014
sa11648 Nonsense Available for shipment Available now
sa13529 Nonsense Available for shipment Available now
sa5003 Essential Splice Site F2 line generated During 2014
sa6712 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 91 3411 1 30
ENSDART00000126795 Nonsense 91 3391 1 29
Genomic Location:
Chromosome 22 (position 24352033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGTCATTGTGGATAAAATCTCAGCATCCAAGGGCTTTTCGGTGGAT[C/T]AAATGTCGTTCACAATACAGGTAATAGCAAATATACAAATGATTATGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa447
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Essential Splice Site 97 3411 1 30
ENSDART00000126795 Essential Splice Site 97 3391 1 29
Genomic Location:
Chromosome 22 (position 24352012)
KASP Assay ID:
554-0325.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAGCATCCAAGGGCTTTTCGGTGGATCAAATGTCGTTCACAATACAG[G/T]TAATAGCAAATATACAAATGATTATGTGTCATAAATGTGTAAATATGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 509 3411 3 30
ENSDART00000126795 Nonsense 509 3391 3 29
Genomic Location:
Chromosome 22 (position 24348535)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGAATCGAAAATTTGTCCAGTTGCAAAAAAGAAGYCAACTTYAAATT[T/A]ATCCCCTCATGACCAACTTTTGTCCTCTATTTCTCCCATACGACCTMAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 697 3411 6 30
ENSDART00000126795 Nonsense 677 3391 5 29
Genomic Location:
Chromosome 22 (position 24347310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCAAGGCATCCATTGCCATTTGCGGCAAAAAACATGTTTTATGATGAG[C/T]GATGGATCGAAAAGCAAGAGCGAGGCTTTACTTGGTGGATGAACTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Essential Splice Site 829 3411 8 30
ENSDART00000126795 Essential Splice Site 809 3391 7 29
Genomic Location:
Chromosome 22 (position 24345208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACTGGCTCATATCGTACAATCCACTTTGGCTGCGAATTGGACTTGAG[G/A]TATTTACTTTTCATTGTAAAAGCATACTGTTTGTCTCATCACTTGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1121 3411 14 30
ENSDART00000126795 Nonsense 1101 3391 13 29
Genomic Location:
Chromosome 22 (position 24339758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCCAGTCAGAAAGTGACGCTTCTTATGGACTGGGTYAATGCTGTTTG[T/A]GAGTTCTACAGCTTGAAGGTGATTAGGAAAAAGTTTCCTTGTGTATTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
Genomic Location:
Chromosome 22 (position 24332755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAA[C/T]GATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCRATATGCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
ENSDART00000105628 Nonsense 1834 3411 19 30
ENSDART00000126795 Nonsense 1814 3391 18 29
Genomic Location:
Chromosome 22 (position 24332755)
KASP Assay ID:
554-0912.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCAAAAAGTACCGGAGACAACAGTGGGCCGCATCAGTTTTACAGCAA[C/T]GATTCAGAGCAACGGTGACCAAAAATGCTGTCATGAAGCAATATGCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 1885 3411 19 30
ENSDART00000126795 Nonsense 1865 3391 18 29
Genomic Location:
Chromosome 22 (position 24332600)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCAGATCGCAGAAAAGCAAAAATGTGCTAAAATTATCCAAAAGATGTA[T/A]AGAGCATACAAACAACGTCATGATTACYTTGCTCTTAGGAATGCCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2161 3411 19 30
ENSDART00000126795 Nonsense 2141 3391 18 29
Genomic Location:
Chromosome 22 (position 24331774)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTGCAGCTTTGATTCTGCAAGCAGCCTATCGTGGCAAGAAGACCAGA[C/T]AGGCTTTGAAGCAAATGCACCAAGCTGCAACAATCATTCAGTCCCATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2314 3411 19 30
ENSDART00000126795 Nonsense 2294 3391 18 29
Genomic Location:
Chromosome 22 (position 24331315)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCCTATCGTGGCATGAAGACCAGGCACACGTTGAAGCAAATGCAC[C/T]AAGCTGCAACAATCATTCAGTCCCATGTGAGAATGCGGATCCTTAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2382 3411 19 30
ENSDART00000126795 Nonsense 2362 3391 18 29
Genomic Location:
Chromosome 22 (position 24331110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTTGAWTCTGCAAGCAGCCTATCGTGGCATGAAGACCAGACAAACTT[T/G]AAAACAAATGCACCAGGCTGCCACCATTGTWCAGGCAACTTACCGAKCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 2806 3411 20 30
ENSDART00000126795 Nonsense 2786 3391 19 29
Genomic Location:
Chromosome 22 (position 24329729)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGGAAGGCCAAACTTTTTTCCCCCTTGCTATCAAACAGGCAAATTAT[C/T]GAGGGATGRTTGAGAGACGCAGGTTTCACCAACTCAAGGAGTGTGCWTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5003
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Essential Splice Site 2908 3411 21 30
ENSDART00000126795 Essential Splice Site 2888 3391 20 29
Genomic Location:
Chromosome 22 (position 24329296)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAKTGCCACCATTCGAAGATGTATCCAAGCGAGACGCCAACGCTCTAAG[T/A]AAGAAATTAAAGATATTATTTTGTTTATTMATTTTTTTGCTTTGTGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105628 Nonsense 3089 3411 25 30
ENSDART00000126795 Nonsense 3069 3391 24 29
Genomic Location:
Chromosome 22 (position 24322014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATCTTTCTTTCCCCCRAMTTTCCAGCAATGTTTTAGGGCAAAACTG[C/T]AGAGAAAGRAATATCTRAAAGACAGAGAAGACATCATCAAGACCCAGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6mkwb47k