ptprc

Ensembl ID:
ENSDARG00000071437
ZFIN ID:
ZDB-GENE-050208-585
Description:
Novel protein similar to vertebrate protein tyrosine phosphatase receptor type C (PTPRC) [Source:Uni
Human Orthologue:
PTPRC
Human Description:
protein tyrosine phosphatase, receptor type, C [Source:HGNC Symbol;Acc:9666]
Mouse Orthologue:
Ptprc
Mouse Description:
protein tyrosine phosphatase, receptor type, C Gene [Source:MGI Symbol;Acc:MGI:97810]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43851 Nonsense Mutation detected in F1 DNA During 2017
sa9795 Nonsense Available for shipment Available now
sa39373 Nonsense Mutation detected in F1 DNA During 2017
sa39372 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105607 Nonsense 677 1321 21 35
ENSDART00000137111 Nonsense 249 893 7 21
ENSDART00000137873   None 255 None 7
Genomic Location (Zv9):
Chromosome 22 (position 24723018)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22981747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTCCCCGAATTTTCAACAATTACACCATCAAGGAGGCGAAGAGACCA[G/T]AAAACCAGTCCAAGAACCGCTATGTTGACATCCTGCCTTGTAAATATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105607 Nonsense 1059 1321 31 35
ENSDART00000137111 Nonsense 631 893 17 21
ENSDART00000137873   None 255 None 7
Genomic Location (Zv9):
Chromosome 22 (position 24707457)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22966186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATGCTGTACCAGCAGCAARSTAAAMMAGTTGTTATGCTCACAGACTG[T/A]CAAGAGGACGGCAAGGTATGAACTCCCACARTACCAGASAACAGATAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105607 Nonsense 1094 1321 32 35
ENSDART00000137111 Nonsense 666 893 18 21
ENSDART00000137873   None 255 None 7
Genomic Location (Zv9):
Chromosome 22 (position 24706313)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22965042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGGAGATATGGAAATCGAGGTGAAAAAGACAGAAAGCTTCCCAACATA[T/A]GTAAAACGTCACCTGGAAATACAATCCACAAAGGTAAGTGGAATATCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105607 Nonsense 1195 1321 34 35
ENSDART00000137111 Nonsense 767 893 20 21
ENSDART00000137873   None 255 None 7
Genomic Location (Zv9):
Chromosome 22 (position 24705529)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 22964258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTCATTAACAGAAAAGTTGGTTGACGTCTTCCAAGTGGTCAAAAACT[T/A]GCGCAAGGAGAGACAGGGAATGGTGGAAACATTTGTAAGTTTTAATTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link