myha

Ensembl ID:
ENSDARG00000071435
ZFIN ID:
ZDB-GENE-060531-50
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8392 Nonsense Mutation detected in F1 DNA During 2014
sa7568 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046048 Nonsense 161 1106 4 25
ENSDART00000122669 Nonsense 145 364 3 10
Genomic Location:
Chromosome 5 (position 33885536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCTACAAGTGGCTCCCAGTGTATGACGCAGAAGTGGTTGCTGCCTAC[A/T]GAGGCAAAAAGCGTATGGAGGCTCCACCCCACATCTTCTCTGTCTCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046048 Missense 736 1106 19 25
ENSDART00000122669 None None 364 None 10

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 5 (position 33889011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTCAGGTGTTCTTCAAAGCTGGTCTKCTGGGTACTCTTGAGGAGATG[C/A]GTGATGAGAAACTGGCTAGTCTGGTCACAATGACYCAGGCTCTCTGCCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/usrjh0ft