ap3d1

Ensembl ID:
ENSDARG00000071424
ZFIN ID:
ZDB-GENE-050208-437
Description:
AP-3 complex subunit delta-1 [Source:RefSeq peptide;Acc:NP_001038480]
Human Orthologue:
AP3D1
Human Description:
adaptor-related protein complex 3, delta 1 subunit [Source:HGNC Symbol;Acc:568]
Mouse Orthologue:
Ap3d1
Mouse Description:
adaptor-related protein complex 3, delta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:107734]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24163 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8748 Nonsense Mutation detected in F1 DNA During 2014
sa10591 Nonsense Available for shipment Available now
sa25180 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105580 Essential Splice Site 64 1247 2 33
Genomic Location:
Chromosome 22 (position 22581268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGACAACATCGCCGTTAAAGCCAACGCCGTCTGCAAGCTCACCTACG[T/A]AAGGCTGACAGTCGCATCATTCAGATTTCTTTTTTCTTTTGAGCTCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105580 Nonsense 90 1247 3 33
Genomic Location:
Chromosome 22 (position 22581105)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCTGCTTTCAACATTGTGGAGGTCATGAGCTCCTCCAAATTCACTTA[T/A]AAGGTGAGAGGAGGCGTCAGAATCAWTGTTTTATATGTCTGTATGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105580 Nonsense 309 1247 11 33
Genomic Location:
Chromosome 22 (position 22573246)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTTTCCWTTTCTCTCTCTCTCGTCSACAGCTCTGTGTGCAGAAACTG[C/T]GAATCCTRATTGAAGACTCGGACCAGAACTGTGAGCCTTCTGTCAATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105580 Essential Splice Site 715 1247 19 33
Genomic Location:
Chromosome 22 (position 22559953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACATCCCAGTGGTGCAGATTGACCTTAGTGTGCCTCTCAAAGTCCCAG[G/T]TGAGCAAAGTGATCTAGTAAAATCCTCCATAAGGGAACGTAGAATAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jdn7p15b