gbx1

Ensembl ID:
ENSDARG00000071418
ZFIN ID:
ZDB-GENE-020117-2
Description:
gastrulation brain homeobox 1 [Source:RefSeq peptide;Acc:NP_777286]
Human Orthologue:
GBX1
Human Description:
gastrulation brain homeobox 1 [Source:HGNC Symbol;Acc:4185]
Mouse Orthologue:
Gbx1
Mouse Description:
gastrulation brain homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:95667]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu3379 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu3379
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105572 Nonsense 309 316 2 2
Genomic Location (Zv9):
Chromosome 24 (position 35436124)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34229598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCATTCCAGTGCACGTCAACAGGTTCGCGGTGCGGAGTCAACATCAA[C/T]AGATCGAACCGGGCAGCAGGCCATGAATGAACTCCTCAATATAAATGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link